Loading ALS Journal

Advertisement area

Submit your research

Advancements in Life Sciences

Advancement in Life Science

Submit your research
Article Sections

Edited by

Muhammad Azam AliVirtual University of the Pakistan

Reviewed by

Arslan SarwarWalster Hall, North Dakota State University, ND, USA
Dr Nadir UllahUniversity of Genova, Italy
Dr Faisal SiddiqueCholistan University of Veterinary and Animal Sciences, Bahawalpur, Pakistan

Figures

Tables

  • Full Length Research Article
  • Date Received: 25-12-2023
  • Date Revised: 13-09-2026
  • Date Accepted: 03-10-2026
  • Date Published: 28-10-2026
Comparative effects of organic acids and aqueous extract of Allium sativum and Zingiber officinale on survival of Campylobacter jejuni on chicken meat
Saira Gul1,2, Muhammad Asad Ali2, Aftab Ahmad Anjum2, Muhammad Avais2
  1. Abdul Wali Khan University, Mardan, Pakistan
  2. University' of Veterinary and Animal Sciences, Lahore, Pakistan

Abstract

Background: Microorganisms have developed resistance as a result of the overuse of antibiotics. Finding alternatives to restrict the proliferation of microorganisms, especially those derived from plants, that are readily available and have notably fewer negative effects is therefore imperative. The current study compared the antibacterial properties of organic acids (lactic and acetic acids), Zingiber officinale, and Allium sativum aqueous extracts against Campylobacter jejuni‘s ability to survive on chicken meat.

Methods: An agar well diffusion assay was used to measure the antibacterial activity of each organic acid and aqueous extract against five Campylobacter jejuni isolates. Using the broth microdilution method, the aqueous extracts’ Minimum Inhibitory Concentration (MIC) was examined. Using a food model, the log reduction test was used to assess the extracts’ and organic acids’ antibacterial properties.

Results: The highest zone of inhibition was seen against Allium sativum (22±2.00mm), followed by Zingiber officinale (20.3±1.5mm), lactic acid (15.3±0.5mm) and acetic acid (13.6±0.5mm), and Allium sativum and Zingiber officinale were found to have MICs of 3.5% and 2.5% (v/v), respectively. After 100 minutes of contact at 25°C, aqueous extract of Allium sativum showed the best results (3.31±0.39 log CFU/g) on the log reduction assay followed by Zingiber officinale (2.36±0.13 log CFU/g), lactic acid (2.22±0.02 log CFU/g) and acetic acid (1.36±0.09 log CFU/g).

Conclusion: Allium sativum, Zingiber officinale, and organic acids have potent anti-campylobacter properties and can be utilized safely to lower the Campylobacter jejuni load when processing chicken meat.

Keywords

Organic acid, Zingiber officinale, Allium sativum, Campylobacter jejuni, log reduction assay, campylobacteriosis

Introduction

Poultry sector of Pakistan contributes remarkably to bridging the gap between demand and supply of meat protein. However, this industry is facing a lot of problems such as disease outbreaks, price fluctuations, etc. Poultry meat is main concern for the safety of consumers, producers and public health. The surface of chicken meat is usually contaminated by droppings as well as slaughterhouse environmental microorganisms when slaughtered and processed. In poultry, important pathogenic bacteria are Salmonella typhimurium, Salmonella enteritidis, Escherichia coli, Shigella, Campylobacter, Listeria, Staphylococcus aureus and many others [1, 2]. Campylobacter is the most important and common cause of bacterial gastroenteritis around the world. World Health Organization (WHO) estimated that the occurrence of Campylobacteriosis is 1 in 4 causes of gastrointestinal disease in both developing and developed countries. The organism is microaerophilic, gram-negative, curved rod, corkscrew motility and oxidase positive. Campylobacter is considered as a commensal bacterium in poultry and transmission of Campylobacter species is predominant among chicken. There are many sources of Campylobacter entry into commercial poultry flocks (includes egg transmission), including the environment. Fecal bacteria, including Campylobacter, can contaminate the shell, its membranes and albumen of fertile eggs which are freshly laid [3].

Approximately 80% cases of campylobacteriosis in human beings have resulted due to consumption of contaminated chicken meat worldwide [4, 5].  The genus Campylobacter includes both non-pathogenic species that live in a wide variety of reptiles, mammals, birds, and mollusks, as well as species that are known to be harmful to humans and animals. Currently, the Campylobacter genus includes 31 species and 13 subspecies which include C. lanienae, C. gracilis, C. blaseri, C. coli, C. hyointestinalis, C. jejuni, C. hominis, and C. ureolyticus [6]. Campylobacter jejuni (C. jejuni) is accountable for 5-14% cases of diarrhea worldwide, which interprets into about 400-500 million case reports per year [7]. Some cases of Campylobacteriosis however, can be asymptomatic carriage phase and associated with sequelae, in particular, irritable bowel syndrome (IBS), Guillain-Barré Syndrome (GBS) and Reactive Arthritis (RA) [8]. GBS leads to flaccid paralysis and immune mediated illness [9].

Antimicrobial drugs have a major role in reducing the worldwide burden of infectious diseases that impact the respiratory, neurological, and gastrointestinal systems. The unnecessarily use of antibiotics has encouraged the microorganisms to acquire resistance which now have become a serious predicament. Thus, there is a critical need to find the substitutes or alternative in treatment of diseases predominantly those of plants source which have noticeably fewer side effects and easily available [10]. Numerous plants have antimicrobial potential owning to their phytochemicals synthesized in the secondary metabolism of the plant.

The use of Allium sativum as a medicine has been common throughout human history [11]. Antimicrobial activity of Allium sativum is due to different active compounds including diallyl sulphide (DAS), diallyl disulphide (DADS), n-acetyl cysteine (NAC) and s-ethyl cysteine (SEC). The presence of DADS and DAS in Allium sativum inhibits the growth of bacteria and decreased the majority of aerobes, S. aureus, S. typhymurium, E. coli, C. jejuni and Listeria monocytogenes (p < 0.05). Zingiber officinale is another well-known medicinal plant with numerous applications as in traditional medicine and food industries. Zingerone in Zingiber officinale is one of the active constituents against heat-labile toxin (enterotoxin) produced by E. coli [12].

Naturally existing alternatives are needed to get a high degree of protection with respect to foodborne pathogens. In past, some treatments were used to eliminate or prevent Campylobacter population on raw poultry products like hydrogen peroxide, adopting chlorine and trisodium phosphates. However, consumers are eluding food items prepared with preservatives of chemical origin and thus natural substitutes are needed. Those naturally existing additives can also extend shelf life of food products and high degree of safety with respect to foodborne pathogens [13]. Organic acids can either be used in processing plants for treatment of carcasses (poultry) or as food supplements. A limited reduction of Campylobacter growth in chicken was recorded which were fed with feed additives including acetic and lactic acids. Additionally, the US Department of Agriculture Food Safety and Inspection Services (USDA FSIS) and the US Food and Drug Administration have designated organic acids as generally recognized as safe (GRAS) [12].

Large number of organic acids are found in a variety of fermented foods and fruits, including ascorbic, acetic, lactic, tartaric, citric, propionic, malic and succinic acids and in lesser quantity, none of those acids are harmful to human health [14]. Due to the contamination from intestinal contents, Campylobacter is largely found on the skin of poultry at processing units [15]. Chlorine (sodium hypochlorite) is frequently used during meat processing to decrease pathogen burdens on carcasses. Though, chlorine efficiently reduces Campylobacter and Salmonella by as much as 1 to 2 log10 on poultry carcasses, respectively. However, organic matter such as fat or blood can neutralize the effect of chlorine, thus making it ineffective. On the other hand, chlorine treatment produces trichloramine and toxic gases. Therefore, highly effective substitute methods are needed to disinfect poultry carcasses that are compliant with food standards [16]. Risk assessments of Campylobacter have determined that a 2-log reduction on the counts of Campylobacter on chicken meat resulted in 30-fold reduction of Campylobacteriosis cases in human beings linked with consumption of chicken meat [17].

Keeping in view the significance of public health and poultry industry in Pakistan, this research was planned to compare the antimicrobial property of aqueous extract of Zingiber officinale and Allium sativum with the organic acids against C. jejuni on chicken meat.

Methods

Sample collection

Fresh bulbs of Zingiber officinale and Allium sativum were purchased from the local market of Lahore. Organic acids including Acetic Acid (2%) and Lactic Acid (3%) were procured from the Institute of Microbiology, UVAS, Lahore.

Preparation of aqueous extract of Allium sativum and Zingiber officinale

Zingiber officinale and Allium sativum cloves were separated and peeled to obtain the edible part. The edible portion was sliced and sterilized using 70% ethyl alcohol. Zingiber officinale was homogenized using sterile mortar and pestle. The homogenized solution was filtered through cheesecloth and sterilized by membrane filter (0.45-micron sterile filter). The filtrate was collected in a labeled sterile falcon tube and stored at 4°C [18].

Media preparation

Charcoal Cefoperazone Deoxycholate Agar (CCDA), Bolton’s Enrichment Broth and Mueller Hinton Agar were prepared to cultivate the bacterial colonies. MH agar is a non-selective medium used for antimicrobial susceptibility testing due to its consistency in supporting bacterial growth and diffusion of antimicrobial agents. Bolton broth enrichment broth is a selective liquid medium used for enrichment of Campylobacter species, containing antibiotics to inhibit competing flora [19].

Confirmation of bacterial culture

Five C. jejuni isolates were obtained from the University of Veterinary and Animal Sciences’ Institute of Microbiology in Lahore. Bolton broth enrichment broth was used to re-cultivate these isolates after 48 hours at 42°C in microaerophilic conditions (5% O2, 10% CO2, 85% N2). Modified Charcoal Cefoperazone Deoxycholate Agar (mCCD agar) was streaked with enriched Bolton broth following a 48-hour incubation period. Gram staining, negative staining, and biochemical tests (catalase, oxidase, and hippurate hydrolysis) were used to validate the isolates. The isolates were further confirmed by polymerase chain reaction using C. jejuni specific primers against mapA gene (5′ CTATTTTATTTTTGAGTGCTTGTG3′-F and 5’GCTTTATTTGCCATTTGTTTTATTA3′-R) [19]. The modified Kirby Bauer well diffusion method was used to conduct the antimicrobial sensitivity test in accordance with the guidelines set out by the Clinical and Laboratory Standards Institute (CLSI).

Determination of antimicrobial activity of Zingiber officinale, Allium sativum and organic acids (Lactic acid and Acetic acid) by agar well diffusion assay:

The agar well diffusion assay was performed on Mueller Hinton agar (MHA) supplemented with 5% defibrinated lysed sheep blood. Bacterial cultures suspension was set to 0.5 McFarland standards containing 1.5×108 CFU/ml by suspending bacterial colonies in 4-5ml of Muller-Hinton (MH) broth. The MHA petri plates were lawn cultured with adjusted microbial culture suspension. Wells were punctured on agar plate and sealed with molten agar. Organic Acids including Acetic acid (AA), Lactic acid (LA), Allium sativum and Zingiber officinale (100 μL of each) were poured into wells on petri plates. The plates were incubated for 48 h and zones of inhibition were measured. The organic acids and plant extracts were tested in duplicate against C. jejuni isolates for accuracy and reproducibility [20].

Determination of Minimum Inhibitory Concentration (MIC)

The broth micro dilution method was used to determine the MIC according to CLSI. Two-fold serial dilutions of each crude aqueous extract (taken as 100% v/v) were prepared in Mueller Hinton broth. As the test agents were crude liquid extracts rather than purified compounds, MIC values were expressed as the percentage of crude extract in the final well volume (% v/v), where 1% v/v corresponds to 10 µL of extract per mL. Mueller Hinton broth and the bacterial inoculum were added to a final concentration of 1.5 × 108 CFU/mL in selected wells. The microdilution plate was enclosed with a sterile sealer and incubated for 48 h at 42°C. The lowest concentration of Allium sativum and Zingiber officinale aqueous extracts which inhibited the visible growth of bacteria was declared as MIC value [21].

Food model and log reduction Assay

Raw chicken meat was purchased from the local market of Lahore and brought into Post graduate laboratory of Institute of Microbiology, UVAS, Lahore.  Skin was detached from any fat layer with a knife. Samples were sterilized by exposure to UV light at a wavelength of 254 nm and an intensity of 0.08–0.10 mW/cm² (80–100 μW/cm², measured at the working surface per NSF/ANSI 49 standards) for 25–30 minutes in open aluminum foil within a Class II Type A2 biosafety cabinet.  The meat pieces were divided into four groups including A, B, C and D and were exposed to 1.5×108 CFU/mL of Campylobacter jejuni suspension for 20 minutes, and further treated with Zingiber officinale, Allium sativum, AA (1%) and LA (3%), respectively. Two parameters, temperature (4 and 25℃) and contact time (10, 40, 70 and 100 minutes) were assessed for all treatments. Further, treated meat samples were taken and homogenized for 1 minute in Stomacher® 400 Circulator (Seward Ltd., Worthing, West Sussex, UK). After thorough mixing, 1mL of sample homogenate was taken and mixed with 9mL of 1% peptone water and then serially diluted (10 folds). Dilutions up to 10-10 were inoculated onto CCDA plates and incubated under micro-aerophilic conditions at 42°C for 48 hrs. Viable counts were counted and converted to log10 values. Log reduction was calculated by subtracting the log counts from initial counts of C. jejuni [22].

Statistical analysis

Result’s data was analyzed through statistical package for social sciences (SPSS) using descriptive statistics (mean ± SD), and one-way ANOVA with significance set at p < 0.05 [22].

Results

Five isolates of Campylobacter jejuni were procured from Institute of Microbiology UVAS, Lahore. The isolates were initially refreshed, cultured and confirmed by Gram’s staining, biochemical testing (oxidase, catalase, hippurate hydrolysis) and Molecular assay (PCR) shown in figure 1 and 2.

Assessment of the antimicrobial activity of aqueous extract of Zingiber officinale, Allium sativum and Acetic and lactic acids was identified initially by the agar well diffusion assay against C. jejuni isolates. The current study revealed that both the aqueous extracts and organic acids used in the study exhibited a varying degree of antimicrobial activity against C. jejuni isolates showed in Table 1. 

The efficiency of the aqueous extracts for bacterial isolates was determined by assessing the minimum inhibitory concentration (MIC).  MIC was only performed for aqueous extracts as they were processed in concentrated (100% v/v) form. The MIC was calculated using micro broth dilution technique and shown in table 2.

It was concluded that Allium sativum (3.31±0.39 log CFU/g) had better results in terms of log reduction against C. jejuni on chicken meat at 25°C for 100 minutes followed by Zingiber officinale (2.36±0.13 log CFU/g) at 25°C for 100 minutes, lactic acid (2.22±0.02 log CFU/g) at 25°C for 100 minute and acetic acid (1.36±0.09 log CFU/g) for 100 minutes at 25°C, respectively. All treatments were successful in reducing the growth of C. jejuni (figure 3 and figure 4). Statistically significant difference (p < 0.05) was observed between treatment methods.

Discussion

Campylobacter jejuni is one of the major food-borne pathogens. Poultry is considered as one of the important and major reservoirs of Campylobacter species thus represents a significant vehicle for transmission to humans [23]. Poultry meat still represents the most significant source of food-borne Campylobacter. As the meat sector is concerned, poultry meat sold at retail represents one of the most vital vehicles for the diffusion of Campylobacter infection, thus represent a risk for consumer health [24]. Studies from 1990 to 2013 reported Campylobacter as the fourth important cause of diarrheal illness after rotavirus, cryptosporidiosis and typhoid fever [25].

Contamination usually occurs both in poultry slaughter units and on the poultry farms. Routine practices on farms such as poultry handling, transportation practices and feed withdrawal have a known effect on Campylobacter bacteria levels at the poultry processing plant. At the processing plant, evisceration, carcass chillers and defeathering have been known to spoil or cross‐contaminate the poultry carcasses. Washing of carcass and use of proper processing aids have been shown to decrease the burden of Campylobacter in the poultry carcasses [3]. Cattle and poultry have long been identified as the major reservoirs for the Campylobacter species isolated from human cases in the Netherlands, with about 60–80% of cases being related to chicken and 20–30% cases to cattle based on Multilocus Sequence Typing data, irrespective of the transmission route involved [26].

Allium sativum aqueous extract was designated as the better extract than methanol extracts due to the high percentage yield of total phenolic compounds. The utilization of natural antimicrobial agents for preservation of food has gained a lot of attention by consumers [27]. Organic acids such as sorbic acid, acetic acid, and benzoic acid are extensively used as preservatives in the food industry.

On Campylobacter, the effects of organic acids may vary depending whether testing is performed in a food matrix or in broth as meat may have a defensive effect due to buffering capability [28]. In the present study, all the treatment methods decreased C. jejuni number, though the reductions varied depending on time, exposure and treatment. A previous study reported that 2-3 log-CFU/mL reduction of C. jejuni was also achieved when the Allium sativum concentrate at 25μL/mL was used at 4°C. He also reported that at 22°C, Allium sativum showed greater bactericidal effect than at 4°C [29]. Results also showed highest log reduction (3.31±0.39 log CFU/g) at 25°C for 100 minutes.

Allium sativum, famous flavoring agent and food spice, has also been used for a long time traditionally to treat several ailments specifically bacterial infections in various cultures for centuries around the world. The major phytochemicals found in Allium sativum that has antibacterial activity are organosulfur compounds which include allyl sulfides, allicin and ajoenes. These compounds exhibit antibacterial properties such as anti-quorum sensing activity, antitoxin, antibiofilm and bactericidal against a large number of bacteria including multi-drug resistant (MDR) strains [30].

Many studies have reported that Allium sativum aqueous extract has the highest antimicrobial activity against Pseudomonas aeruginosa (18.3mm ± 0.72) while with methanolic Allium sativum extract, (11mm ± 0) zone of inhibition was reported against Pseudomonas aeruginosa. Allium sativum methanol extract was less effective against tested bacteria [31]. Our results were also similar to the results of other studies in which using 5% acetic acid, zone of inhibition (19mm) was reported against C. jejuni [32].

In present study, we used less concentrated (2%) Acetic acid which showed (13.6±0.5mm) inhibition zone against C. jejuni while aqueous extract of Allium sativum showed 22mm zone of inhibition. This may be due to different plant extraction methods as we used aqueous extract in our study. A study was conducted to assess the effect of lactic acid washing on the counts of C. jejuni on chicken meat stored at 4°C and showed that treatment with 2% lactic acid reduced C. jejuni counts 1.42 log units [33]. In our study, the highest mean log reduction (2.22±0.02 log CFU/g) of C. jejuni by Lactic acid (3%) was recorded at 25°C temperature and 100 minutes exposure time. With higher temperatures, the diffusion of organosulphur components of Allium sativum into bacterial cells are also exhibited the better antimicrobial effects during log phase of bacterial growth [30].

A similar study was also designed to assess the antimicrobial properties of the ethanolic extracts of Allium sativum and Zingiber officinale on two Gram-positive and five Gram-negative bacterial strains. The overall maximum inhibition was recorded with Allium sativum (13.52 mm zone of inhibition against Pseudomonas aeruginosa), whereas the least inhibition was observed in Zingiber officinale (12.43 mm). The minimum inhibitory concentration for Allium sativum was observed to be 67 µg/mL which is comparable to current study [34]. Concentrations of organic acids (0.5-2 %) were very effective in reducing the growth of C. jejuni. The influence of the organic acids was also associated with the value of undissociated acid. The lesser the pH, the high will be the level of undissociated organic acid thus can easily cross the membrane and enter the microbial cell causing decline in pH [35].

It was concluded that organic acid and aqueous extract of Zingiber officinale and Allium sativum had antimicrobial activities against C. jejuni on chicken meat. Thus, treatment of chicken with organic acid and plant extracts can be helpful in reducing the C. jejuni burden on chicken meat. Organic acids and aqueous extracts can be used safely in poultry processing units for washing of carcasses and thus can help in reducing the entry of C. jejuni in food chain. Moreover, future research is needed to identify other naturally occurring compounds to decontaminate the chicken meat without imposing any health hazard on human beings.

Conclusion

Statement & Declarations

Conflict of Interest

The authors state that none of the work described in this study could have been influenced by any known competing financial interests or personal relationships.

Author Contributions

Saira Gul and Muhammad Asad Ali were primarily responsible for the conceptualization of the study, and designing of methodology. Saira Gul conducting the experiments, analyzing the data, and drafting the initial manuscript. Muhammad Asad Ali and Aftab Ahmad Anjum provided overall supervision, project administration, and critically reviewed the manuscript for content. Muhammad Avais contributed by providing resources, technical support, and validation of results.

Acknowledgment

This research work was supported by Higher Education Commission (HEC) project # 7058/Punjab/NRPU/R&D/HEC/2017.

References

  1. Raza H, Ali MA, Nawaz M, Ali MM, Mehmood A, Nasir J, Beig MM. Evaluation of the combined effect of probiotic Lactobacillus gallinarum PL53 and organic acids on mitigation of Campylobacter jejuni infection in broilers. Egyptian Journal of Veterinary Sciences, (2026); 57: 1-8.
  2. Raza A, Ahmad S, Ahmad M, Zain-Ul-Abedin M, Channo A, Subhan A, et al. Zoonotic diseases: emerging threats to public health and livestock production. Zoonosis, (2023); 1: 74-88.
  3. Cox NA, Richardson LJ, Maurer JJ, Berang ME, Fedorka-Cray PJ, Buhr RJ, Byrd JA. Evidence for horizontal and vertical transmission in Campylobacter passage from hen to her progeny. Journal of Food Protection, (2012); 75(10): 1896–1902.
  4. Doğan ANC, Çelik E, Kılıçle PA, Atalay E, Sağlam AG, Doğan A, Otlu S. Antibacterial effect of hot peppers (Capsicum annuum, Capsicum annuum var globriusculum, Capsicum frutescens) on some Arcobacter, Campylobacter and Helicobacter species. Pakistan Veterinary Journal, (2018); 38: 266-270.
  5. Keener KM, Bashor MP, Curtis PA, Sheldon BW, Kathariou S. Comprehensive review of Campylobacter and poultry processing. Comprehensive Reviews in Food Science and Food Safety, (2004); 3(2): 105-116.
  6. Hermans D, Pasmans F, Messens W, Martel A, Van Immerseel F, Rasschaert G. Poultry as a zoonotic pathogen Campylobacter jejuni. Vector Borne Zoonotic Disease, (2012); 12: 89-98.
  7. Bahrndorff S, Rangstrup-Christensen L, Nordentoft S, Hald B. Foodborne disease prevention and broiler chickens with reduced Campylobacter infection. Emerging Infectious Diseases, (2013); 19(3): 425-430.
  8. Imbrea AM, Balta I, Dumitrescu G, McCleery D, Pet I, Iancu T, Stef L, Corcionivoschi N, Liliana PC. Exploring the contribution of Campylobacter jejuni to post-infectious irritable bowel syndrome: A literature review. Applied Sciences, (2024); 14(8): 3373.
  9. Friedman CR, Neimann J, Wegener HC, Tauxe RV. Epidemiology of Campylobacter jejuni infections in the United States and other industrialized nations. In: Nachamkin I, Blaser MJ, editors. Campylobacter. 2nd ed. Washington, DC: ASM Press; (2000): 121-138.
  10. Myintzaw P, Jaiswal AK, Jaiswal S. A review on campylobacteriosis associated with poultry meat consumption. Food Reviews International, (2023); 39(4): 2107-2121.
  11. Yaniv Bachrach Z. Garlic as a medicine throughout the ages. World Academy of Sciences Journal, (2025); 7(3): 49.
  12.  Joe MM, Jayachitra J, Vijayapriya, M. Antimicrobial activity of some common spices against certain human pathogens. Journal of medicinal plant research, (2009); 3(11): 1134-1136.
  13. Hakeem MJ, Lu X. Survival and control of Campylobacter in poultry production environment. Frontiers in Cellular and Infection Microbiology, (2021); 10: 615049.
  14. Fang TJ, Hsueh YT. Effect of chelators, organic acid and storage temperature on growth of Escherichia coli O157:H7 in ground beef treated with nisin, using response surface methodology. Journal of Food and Drug Analysis, (2000); 8:187-194.
  15. Molatová Z, Skřivanová E, Macias B, McEwan N, Březina P, Marounek M. Susceptibility of Campylobacter jejuni to organic acids and monoacylglycerols. Folia Microbiologica, (2010); 55(3): 215-220.
  16. Lee CF, Han CK, Tsau JL. In vitro inhibitory activity of Chinese leek extract against Campylobacter species. International journal of food microbiology, (2004); 94(2): 169-174.
  17. Horrocks SM, Anderson RC, Nisbet DJ, Ricke SC. Incidence and ecology of Campylobacter jejuni and coli in animals. Anaerobe, (2009); 15(1-2): 18-25.
  18.  Durairaj S, Srinivasan S, Lakshmanaperumalsamy P. In vitro antibacterial activity and stability of garlic extract at different pH and temperature. Electronic Journal of Biology, (2009); 5(1): 5-10.
  19.  Denis M, Refrégier-Petton J, Laisney MJ, Ermel G, Salvat G. Development of a m-PCR assay for simultaneous identification of Campylobacter jejuni and Campylobacter coli. Letters in Applied Microbiology, (1999); 29(6):406-410.
  20.  Durairaj S, Srinivasan S, Lakshmanaperumalsamy P. In vitro antibacterial activity and stability of Allium sativum extract at different pH and temperature. Electron Journal biology, (2009); 5(1): 5-10.
  21. Frasao BDS, Marin VA, Conte‐Junior CA. Molecular Detection, Typing, and Quantification of Campylobacter spp. in Foods of Animal Origin. Comprehensive reviews in food science & food safety, (2017); 16: 721-734.
  22. Jarriyawattanachaikul W, Chaveerach P, Chokesajjawatee N. Antimicrobial activity of Thai-herbal plants against food-borne pathogens E. coli, S. aureus and Campulobacter jejuni. Agriculture and Agricultural science procedia, (2016); 11: 20-24.
  23. Sasidharan I, Menon AN. Comparative chemical composition and antimicrobial activity of fresh and dry Zingiber officinale oils (Zingiber officinale Roscoe). International Journal of Current Pharmaceutical Research, (2010); 2(4): 40-43.
  24. Petruzzelli A, Foglini M, Vetrano V, Paolini F, Orazietti N, Ambrosini B, Osimani A, Clementi F, Tavoletti S, Tonucci F. The occurrence of thermotolerant Campylobacter spp. in raw meat intended for public catering. Public Health, (2014); 128: 388-390.
  25. Harris CM, Williams SK. The Antimicrobial Properties of a Vinegar-based Ingredient on Salmonella Typhimurium and Psychrotrophs Inoculated in Ground Chicken Breast Meat and Stored at 3±1°C for 7 days. Journal of Applied Poultry Research, (2019); 28(1): 118–123.
  26. Hwang H, Singer RS..Survey of the U.S. Broiler Industry regarding Pre- and Postharvest Interventions Targeted to Mitigate Campylobacter Contamination on Broiler Chicken Products. Journal of Food Protection, (2020); 83(7): 1137–1148.
  27. Mughini-Gras L, Pijnacker R, Coipan C, Mulder AC, Veludo AF, de Rijk S, et al. Sources and transmission routes of campylobacteriosis: A combined analysis of genome and exposure data. Journal of Infection, (2021); 82(2): 216-226.
  28. Wang G, Zhao Y, Tian F, Jin X, Chen H, Liu X, Zhang Q, Zhao J, Chen Y, Zhang H. Screening of adhesive lactobacilli with antagonistic activity against Campylobacter jejuni. Food Control, (2014); 44: 49-57.
  29. Cody AJ, Maiden MC, Strachan NJ, McCarthy ND. A systematic review of source attribution of human campylobacteriosis using multilocus sequence typing. Eurosurveillance, (2019); 24(43): 1800696.
  30. Rasul Suleria HA, Sadiq Butt M, Muhammad Anjum F, Saeed F, Batool R, Nisar Ahmad A. Aqueous Allium sativum extract and its phytochemical profile; special reference to antioxidant status. International Journal of Food Science Nutrition, (2012); 63(4): 431-439.
  31. Bhatwalkar SB, Mondal R, Krishna SBN, Adam JK, Govender P, Anupam R. Antibacterial properties of organosulfur compounds of garlic (Allium sativum). Frontiers in Microbiology, (2021); 12: 613077.
  32. Lu X, Rasco BA, Jabal JM, Aston DE, Lin M, Konkel ME. Investigating antibacterial effects of Allium sativum (Allium sativum) concentrate and Allium sativum-derived organosulfur compounds on Campylobacter jejuni by using Fourier transform infrared spectroscopy, Raman spectroscopy, and electron microscopy. Applied and Environmental Microbiology, (2011); 77(15): 5257-5269.
  33. Gonzalez-Fandos E, Maya N, Martínez-Laorden A, Perez-Arnedo I. Efficacy of lactic acid and modified atmosphere packaging against Campylobacter jejuni on chicken during refrigerated storage. Foods, (2020); 9(1):109
  34. Gull I, Saeed M, Shaukat H, Aslam, SM, Samra ZQ, Athar AM. Inhibitory effect of Allium sativum and Zingiber officinale extracts on clinically important drug resistant pathogenic bacteria. Annals of Clinical Microbiology and Antimicrobials, (2011); 11(1): 1-6.
  35. Stanojevic‐Nikolic, S, Dimic G, Mojovic L, Pejin J, Djukic‐Vukovic A, Kocic‐Tanackov S. Antimicrobial activity of lactic acid against pathogen and spoilage microorganisms. Journal of Food Processing and Preservation, (2016); 40(5): 990-998.
Article Sections

Edited by

Muhammad Azam AliVirtual University of the Pakistan

Reviewed by

Arslan SarwarWalster Hall, North Dakota State University, ND, USA
Dr Nadir UllahUniversity of Genova, Italy
Dr Faisal SiddiqueCholistan University of Veterinary and Animal Sciences, Bahawalpur, Pakistan

Figures

Tables

Editors & Reviewers

Edited by

Muhammad Azam AliVirtual University of the Pakistan

Reviewed by

Arslan SarwarWalster Hall, North Dakota State University, ND, USA
Dr Nadir UllahUniversity of Genova, Italy
Dr Faisal SiddiqueCholistan University of Veterinary and Animal Sciences, Bahawalpur, Pakistan

Figures

Tables

Download PDF
Download Pdf

Share this article:

Guidelines

Explore

Connect

Creative Commons License

This website and all of its content is licensed under CC BY NC. This license lets others remix, tweak, and build upon our work non-commercially, and although their new works must also acknowledge us and be non-commercial. More details of the license can be found here.

Creative Commons License
This work is licensed under a Creative Commons Attribution-NonCommercial 4.0 International License.          

Access old site by Clicking here.

© 2026 Advancements in Life Sciences. All rights reserved.